View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_167 (Length: 259)
Name: NF10233A_low_167
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_167 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 256
Target Start/End: Complemental strand, 44952478 - 44952232
Alignment:
| Q |
7 |
aagtatgtgtgtgtaagtggtcatcatatcttgacaaacctaagtgcggggaacacaaacacactagatgtggatctatttgttggatcacatgagaaca |
106 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952478 |
aagtatgtgtgtttaa-tggtcatcatatcttgacaaacctaagtgtggggaacacaaacacactagatgtggatctatttgttggatcacatgagaaca |
44952380 |
T |
|
| Q |
107 |
atgagaggggaattcctaagtgacataggcagtacttaattcacgatgtcagaagctaccatgcaacactcctatgttgttttgtgtgtcacatatatgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44952379 |
atgagaggggaattcctaagtgacataggcagtacttaattcacgatgtcagaagctaccatgca--actcctatgttgttttgtgtgtcacatatatgg |
44952282 |
T |
|
| Q |
207 |
acatcgatcgagtagagtgactacatgagttttgattgcatctgtctctg |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44952281 |
acatcgatcgagtagaatgactacatgagttttgattgcatctgtctctg |
44952232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University