View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_169 (Length: 259)
Name: NF10233A_low_169
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_169 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 259
Target Start/End: Original strand, 25904206 - 25904452
Alignment:
| Q |
13 |
atactacaatcctagttgagtcaaatatttcaggtttacaaaaattgattttgtattgcaccacaaccatatccaatccgcatcaaggatatgaaaaagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25904206 |
atactacaatcctagttgagtcaaatatttcaggtttacaaaaattgattttgtattgcaccacaaccatatccaatccgcatcaaggatatgaaaaagg |
25904305 |
T |
|
| Q |
113 |
ttaaaattactgagaacagataaaacagaggtgctgcgcataataacgggacacagccaacattaaaccaatatctgattgtaaaacaaaacgaattcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25904306 |
ttaaaattactgagaacagataaaacagaggtgctgcgcataataacgggacacagccaacattaaaccaatatctgtttgtaaaacaaaacgaattcag |
25904405 |
T |
|
| Q |
213 |
gcaggaccattaaaacattaaggaatacaaaaatagatgttacctga |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25904406 |
gcaggaccattaaaacattaaggaatacaaaaatagatgttacctga |
25904452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University