View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_199 (Length: 250)
Name: NF10233A_low_199
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_199 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 244
Target Start/End: Original strand, 638068 - 638306
Alignment:
| Q |
6 |
gaaaaatataaactttcagaagcaacatgaacgaagagtaataaacgagatagttcattaccactttctgggttcaatcgaatcttaggttttcaaatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
638068 |
gaaaaatataaactttcagaagcaacatgaacgaagagtaataaacgagatagttcattaccactttctgggttcaattgaatcttagggcttcaaatta |
638167 |
T |
 |
| Q |
106 |
ttttaaggatttctaagttcagtctatgggtttgaagagttcaatgggtactgggttccattgatttagacgggagagagggtgagtgagttgttgagtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
638168 |
ttttaaggatttctaagttcagtctatgggtttgaagagttcaatgggtactgggttccattgatttagacgggagagagggtgagtgagttgttgagtg |
638267 |
T |
 |
| Q |
206 |
tgagagtttgacgggttctggtgagatgacgacgatttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
638268 |
tgagagtttgacgggttctggtgagatgacgacgatttc |
638306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 244
Target Start/End: Original strand, 36392821 - 36392872
Alignment:
| Q |
193 |
gagttgttgagtgtgagagtttgacgggttctggtgagatgacgacgatttc |
244 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
36392821 |
gagttgttgcgagtgaaagtttgacgggttctggtgagacgacgacgatttc |
36392872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University