View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_208 (Length: 249)
Name: NF10233A_low_208
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_208 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 38 - 221
Target Start/End: Complemental strand, 22162547 - 22162365
Alignment:
| Q |
38 |
ttcctcttatggttctcctgcatgtggggctgttggtatagtcctcaataacttgcactcttactttctag-gtggctatgttcaaaatattggtcatgc |
136 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
22162547 |
ttcctcttatggttctcctgcctgtggggctattggtatagtcgtcaataactggcactcttactttctagagtggctatcttcaaaatattggtaatgc |
22162448 |
T |
|
| Q |
137 |
aacatctttgaaggctgagatttgtgctacaatgtatgccttagagaaagatgaggaaatgaattggagagacatatggatagaa |
221 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
22162447 |
aacatctttggaagctgagatttgtgctacaatgtatgccttagagaaagatgaggaaatgaatag--gagacatatggatagaa |
22162365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University