View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_209 (Length: 249)
Name: NF10233A_low_209
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_209 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 19076849 - 19076615
Alignment:
| Q |
16 |
atcattgtgtctctctcttcactaatcttaaatagaattaaatcctaagtatcctaagtattaaagtaaaatagattgcagccatatgaattattactta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19076849 |
atcattgtgtctctctcttcactaatcttaaatagaattaaatcctaagtatcctaagtattaaagtaaaatagattgcagccatatgaattattactta |
19076750 |
T |
|
| Q |
116 |
aataaaaggaagtcctaaatgagttggccatacgaattagagctgcgtattaaatagaatgtgactgaaacaaaacatggataatgcatgtctggcaaga |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19076749 |
aataaaaggaaatcctaaatgagttggccatacgaattagagctgcgtattaaatagaatgtgactgaaacaaaacatggataatgcatgtctggcaaga |
19076650 |
T |
|
| Q |
216 |
tcaaagta-aaaagtatttgcgcaatttgtcctta |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
19076649 |
tcaaagtaaaaaagtatttgcgcaatttgtcctta |
19076615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University