View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_210 (Length: 249)
Name: NF10233A_low_210
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_210 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 45929488 - 45929710
Alignment:
| Q |
16 |
gagaagaccctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929488 |
gagaagaccctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
45929587 |
T |
|
| Q |
116 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaattgtcctatcttttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45929588 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaatagtcctatcttttt |
45929687 |
T |
|
| Q |
216 |
gagcaagcagttttctactcttt |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45929688 |
gagcaagcagttttctactcttt |
45929710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University