View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_215 (Length: 248)
Name: NF10233A_low_215
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_215 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 248
Target Start/End: Original strand, 23333376 - 23333604
Alignment:
| Q |
20 |
cacactggttgcaaatttgttatactttttgggagtattacacatagctagaggcaaactcctaaaatgttcgcaatttatcttatgccctgtcgtgcgc |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23333376 |
cacactggttgcaaatttgttataccttttgggagtattacacatagctagaggcaaactcctaaaatgttcgcaatttatcttatgccccatcgtgcgc |
23333475 |
T |
|
| Q |
120 |
atcttcgtaatgacgacattaagcaagccaacgaaatcatttgaattagggattttgtccaacgtaattcagcatattataatgattgtttcatcagaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
23333476 |
atcttcgtaatgacgacattaagcaagccaacgaaatcatttgaattagggattttgtccaacgtaagtcagcatattataatgattgttccatcagaaa |
23333575 |
T |
|
| Q |
220 |
gcagttgacatataaaaaatcacttacag |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23333576 |
gcagttgacatataaaaaatcacttacag |
23333604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University