View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_217 (Length: 248)
Name: NF10233A_low_217
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_217 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 49123413 - 49123182
Alignment:
| Q |
1 |
gggtgtttttaattttgaaaataaattatatgtacatttttgtccttatcttggtcatacccctgccatatacattttctaaactgactatgttatgggt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123413 |
gggtggttttaattttgaaaataaattatatgtacatttttgtccttatcttggtcatacacctgccatatacattttctaaactgactatgttatgggt |
49123314 |
T |
|
| Q |
101 |
aacatgcatgatacaatctgacacgctcagatttgatctatatgagtgacaaaaaatatatccggaagactggaactgaaattggagctgtttatcacca |
200 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123313 |
aacatgcatgatacaatcttacacgctgagatttgatctatatgagtgacaaaaaatatatccgcaagactggaactgaaattggagctgtttatcacca |
49123214 |
T |
|
| Q |
201 |
aagatcaacaactaggaaaatgattgatgtcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
49123213 |
aagatcaacaactaggaaaatgattgttgtcc |
49123182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University