View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_219 (Length: 248)
Name: NF10233A_low_219
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_219 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 5469928 - 5469712
Alignment:
| Q |
15 |
atggacatcacggtgggacacatatcttctaatgaatgatgatcagatccactggttctccatcattaactctctgatgattgttcttttcctttctgga |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5469928 |
atgggcatcacggtgggacacatatcttctaatgaatgatgatcagatccactggttctccatcattaactctctgatgattgttcttttcctttctgga |
5469829 |
T |
|
| Q |
115 |
atggtggcaatgatcatgatgagaactctttacagagacattgccaattataaccagctagacacccaagacgaggcccaagaagaaacagggtggaaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5469828 |
atggtggcaatgatcatgatgagaactctttacagagacattgccaattataaccagctagacacccaagacgaggcccaagaagaaacagggtggaaac |
5469729 |
T |
|
| Q |
215 |
ttgttcatggagatgtt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5469728 |
ttgttcatggagatgtt |
5469712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 43 - 230
Target Start/End: Complemental strand, 48858060 - 48857873
Alignment:
| Q |
43 |
ctaatgaatgatgatcagatccactggttctccatcattaactctctgatgattgttcttttcctttctggaatggtggcaatgatcatgatgagaactc |
142 |
Q |
| |
|
|||||||||||||| || || ||||||||||| || | ||||| | ||||||||||| || ||||| || |||||||||||||| ||| ||||||| | |
|
|
| T |
48858060 |
ctaatgaatgatgaccaaattcactggttctctattgtaaactcattaatgattgttctctttctttcgggcatggtggcaatgataatgctgagaacac |
48857961 |
T |
|
| Q |
143 |
tttacagagacattgccaattataaccagctagacacccaagacgaggcccaagaagaaacagggtggaaacttgttcatggagatgt |
230 |
Q |
| |
|
| ||| | |||||||| || |||||| |||| || ||||| || || ||||||||||| || || ||||| ||||| ||||| ||||| |
|
|
| T |
48857960 |
tctaccgtgacattgcaaagtataacgagcttgagacccaggaagaagcccaagaagagactggttggaagcttgtccatggggatgt |
48857873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University