View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_240 (Length: 245)
Name: NF10233A_low_240
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_240 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 23870577 - 23870364
Alignment:
| Q |
9 |
gatatatttaggtaaatgcttgcattggtgattctttcttttggaggtgaagttcatcagggattagggtgctttgatcatctcctattagcagcagtgg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870577 |
gatatatttaggtaaatgcttgcattggtgattatttcttttgg--gtgaagttcatcagggattagggtgctttgatcatctcctattagcagcagtgg |
23870480 |
T |
|
| Q |
109 |
ctttgaagacagtgttgtcttgatgttgtcttagtcaacgagcctattattagtagaaagaagctgtgttcagaattttcgcctggtgtgtgtggctacc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23870479 |
ctttgaagacagtgttg-----------tcttagtcaacgagcctattattagtagaaagaagctgtgttcagaattttcgcctggtgtgtgtggcaacc |
23870391 |
T |
|
| Q |
209 |
ttgcagagtatgagtcagttttgcttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
23870390 |
ttgcagagtatgagtcagttttgcttc |
23870364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University