View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_241 (Length: 245)
Name: NF10233A_low_241
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_241 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 15250448 - 15250238
Alignment:
| Q |
15 |
tttcgtgttttgagtttagtgttgttttaactttttagtgcatcatgctaacagtaaataa----tattaactatcatcactttgaaacaaaatagaacc |
110 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
15250448 |
tttcgtgctttgagtttagcgttgttttaactttttagtgcatcatgctaacagtaaataaataatattaactatca---ctttgaaacaaaatagaacc |
15250352 |
T |
|
| Q |
111 |
catgatacatttattaaattaaagtcattctgaccaatatcatctacaaccacatgtttcaaagaccacagaatccaccaggtcccccaaacaacacaac |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15250351 |
catgacacatttattaaattaaagtaattctgaccaatatcatctacaaccacatgttttaaagaccacagaatccaccaggtccaccaaacaacacaac |
15250252 |
T |
|
| Q |
211 |
acgttgcagatcat |
224 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
15250251 |
acgttgcaaatcat |
15250238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University