View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_247 (Length: 243)
Name: NF10233A_low_247
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_247 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 24 - 224
Target Start/End: Original strand, 6307177 - 6307377
Alignment:
| Q |
24 |
ttattgactatgtgaatgtaaacaatatctaaccgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307177 |
ttattgactatgtgaatgtaaacaatatctaactgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatac |
6307276 |
T |
|
| Q |
124 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtgtacctataaaattgcagacaaagaaatcaacttcttacctttcctgtact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307277 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtact |
6307376 |
T |
|
| Q |
224 |
t |
224 |
Q |
| |
|
| |
|
|
| T |
6307377 |
t |
6307377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University