View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_258 (Length: 241)
Name: NF10233A_low_258
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_258 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 63 - 223
Target Start/End: Original strand, 33246068 - 33246228
Alignment:
| Q |
63 |
aaccattaactgattctgaaaagggttcatctgaaagttattagaaaacgagttttcagcattgaaagtgaaaaactcttgacgctgttgatgaacagaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246068 |
aaccattaactgattctgaaaagggttcatctgaaagttattagaaaacgagttttcagcattgaaagtgaaaaactcttgacgctgttgatgaacagaa |
33246167 |
T |
|
| Q |
163 |
gaagaagtaacagaaaaataagaactcgacaccgccgtcatcggagtaggaagcatgatct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246168 |
gaagaagtaacagaaaaataagaactcgacaccgccgtcatcggagtaggaagcatgatct |
33246228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University