View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_263 (Length: 240)
Name: NF10233A_low_263
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_263 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 8845946 - 8845737
Alignment:
| Q |
13 |
atggacatcaaactaaagcctcaaactttatcaccaaatacaactaattctaattgtaattcacccgaatttgaattttggatgctccgaaacccatctt |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8845946 |
atggacactaaactaaagcctcaaactttatcaccaaatacaactaattctaattgtaattcacccgaatttgaattttggatgctccgaaacccatctt |
8845847 |
T |
 |
| Q |
113 |
ttccacaaccaaatcttcacaccgccgaccaacttttcgtcaacggtgttattcttcccctccacctcctccccactactaataaaaccgacccaccacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
8845846 |
ttccacaaccaaatcttcacaccgccgaccaacttttcgtcaacggtgttattcttcccctccacctcctccccaccactagtaaaaccgacccaccacc |
8845747 |
T |
 |
| Q |
213 |
ccaaacacca |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
8845746 |
ccaaacacca |
8845737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University