View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_267 (Length: 240)
Name: NF10233A_low_267
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_267 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 10706205 - 10705975
Alignment:
| Q |
1 |
atcagcaacccttcaagtttcaactaacatacatggaacctacatatcatgttcttgcctgcaaaaattgattgctttcatatattgcaaataaataaat |
100 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10706205 |
atcagcaaactttcaagtttcaactaacatgcatggaacctacatatcatgttcttgcctgcaaaaattgattgcttttatatattgcaaataaataaat |
10706106 |
T |
 |
| Q |
101 |
tttcaattatcatcacaagtactagtactactataactatttgttgacgagtgtataggttgaataaaaaggaaacactagccccccttgtccgtagcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10706105 |
tttcaattatcatcacaagtactagtactactatagctatttgttgacgagtgtataggttgaataaaaaggaaacactagcccaccttgtccgtagcca |
10706006 |
T |
 |
| Q |
201 |
tctaacatttccaattcttaaattccctcac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10706005 |
tctaacatttccaattcttaaattccctcac |
10705975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University