View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_268 (Length: 239)
Name: NF10233A_low_268
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_268 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 22 - 217
Target Start/End: Complemental strand, 11527527 - 11527332
Alignment:
| Q |
22 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527527 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
11527428 |
T |
|
| Q |
122 |
ttatacatgtataatgtaggaacgaaatatgtggacgcgtgtctgcaaatttgaaagagaaacagttcttttaagtttcaatatacagtgccctgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11527427 |
ttatacatgtataatgtaggaacgaaatatgtggatgcgtgtctgcaaatttgaaagagaaacagttctttcaagtttcaatatacagtgccctgg |
11527332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University