View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_27 (Length: 416)
Name: NF10233A_low_27
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Complemental strand, 15749320 - 15748930
Alignment:
| Q |
1 |
tcacatcccgatcggggagaaaattcatgcatggtgaaagagatatctgagatgttcgatgttaatttaagtttcaaacatcttggttcaacgatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15749320 |
tcacatcccgatcggggagaaaattcatgcatggtgaaagagatatccgagatgttcgatgttaatttaagtttcagacatcttggttcaacgatatttt |
15749221 |
T |
|
| Q |
101 |
gttgatacgagggggatccagaaggttacgcagaactacctccttttcatccaactggaatttttatatgacctaaaatattttttggagacttttaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
15749220 |
gttgatacgagggggatccagaaggttacgcagaactacctccttttcatccaactggaattttaaaatgacctaaaatattttttggagacttttaagc |
15749121 |
T |
|
| Q |
201 |
ttattaattctgagatcggaaaggaggaactcatgcaactgttattaattctaagggtctcttaggatgacgtagtgtagaggaagtaggagcttttcta |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15749120 |
tgattaattctgagatcggaaaggaggaactcatgcaacttttattaattctaagggtctcttaggatgacgtagtgtagaggaagtaggagcttttcta |
15749021 |
T |
|
| Q |
301 |
ggtacatcttatcgttttacttttgtctctttggatgtctcatcttatgtcctttttccaggaagaaattgggttttaagttatatgaaga |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15749020 |
ggtacatcttatcgttttacttttgtctctttggatgtctcatcttatgtcctttttccaggaagaaattgggctttaagttatatgaaga |
15748930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University