View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_274 (Length: 239)
Name: NF10233A_low_274
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_274 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 97 - 239
Target Start/End: Complemental strand, 31134027 - 31133885
Alignment:
| Q |
97 |
gaaagtggcatggtggtgatagaaaggggatggagaatttagggttttggtggtggatggaactgagaggagaggccttcagcaaatgnnnnnnnnnnnn |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31134027 |
gaaagtggcatggtggtgatagaaaggggatggagaatttagggttttggtggtggatggaactgagaggagaggcattcagcaaatgtttttgttttct |
31133928 |
T |
|
| Q |
197 |
aaactcaccgtggtgtgggataagccaagttttgttttcacga |
239 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31133927 |
aaactcacagtggtgtggaataagccaacttttgttttcacga |
31133885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University