View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10233A_low_276 (Length: 238)

Name: NF10233A_low_276
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10233A_low_276
NF10233A_low_276
[»] chr3 (1 HSPs)
chr3 (36-202)||(25696905-25697071)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 36 - 202
Target Start/End: Complemental strand, 25697071 - 25696905
Alignment:
36 gatggacatcaatcctagtccaaaaattgatcttgtctatcaaatatattcatatcaatgtagcagcaagactttagattgaacaccaacacacgtggtt 135  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
25697071 gatgcacatcaatcctagtccaaaaattgatcttgtctatcaaatatattcatatcaatgtagcaccaagaatttagattgaacaccaacacacgtggtt 25696972  T
136 acatccagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtctgatgtccat 202  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25696971 acatctagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtctgatgtccat 25696905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University