View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_290 (Length: 234)
Name: NF10233A_low_290
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_290 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 234
Target Start/End: Original strand, 17846878 - 17847104
Alignment:
| Q |
9 |
gctggtggctgccatcttaacatgtttacatcgaaacttctcccctaagtgttctcatt-ctgaagctcgtcacttgcatggcttggtgttgctattaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||| |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
17846878 |
gctggtggctgccatcttaacatggttacatcggaacttctcacctaagtgttctcatttctgaagcttgtcacttgcatggcttggtgtcgctgttaaa |
17846977 |
T |
|
| Q |
108 |
ttaatattgtcactattttgttgtgttgtgtgtggcccctgttgagttgcagtaaccacattcgccattttccaatcctctaccatacatacatccctgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17846978 |
ttaatattgtcactattttgttgtgttgtgtgtggccccttctgagttgcagtaaccgcattcgccattttccaatcctctaccatacatacaaccctgt |
17847077 |
T |
|
| Q |
208 |
ccacaacccatgcagtcgttttcgtga |
234 |
Q |
| |
|
||| ||| ||||||||||||||||| |
|
|
| T |
17847078 |
ccatcacctgtgcagtcgttttcgtga |
17847104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University