View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_292 (Length: 234)
Name: NF10233A_low_292
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_292 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 37 - 217
Target Start/End: Complemental strand, 16193293 - 16193113
Alignment:
| Q |
37 |
catcatgtcggtttattcttggcttgtttaactatttaaaaatattgaaggttggattacaaatttttatatggagtgggaatacctcaactaggaaatt |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16193293 |
catcatgtcagtttattcttggcttgtttaagtacttaaaaatattgaaggttggattacaaatttttatatggagtgggaatacctaaaataggaaatt |
16193194 |
T |
|
| Q |
137 |
ggtcatagtttcttgaaagaaagtttgcaagccactctctgagggaggtaactcacttgaaactttgttggagttttttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
16193193 |
ggtcatagtttcttgaaagaaagtttgcaagccactctctgagggatgtaactcacctgaaactttggtggagttttttga |
16193113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 15576518 - 15576555
Alignment:
| Q |
7 |
gggctggtcaaggcatttgtcacactcagtcatcatgt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15576518 |
gggctggtcaaggcatttgtcacactcagccatcatgt |
15576555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University