View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_307 (Length: 230)
Name: NF10233A_low_307
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_307 |
 | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 47 - 228
Target Start/End: Complemental strand, 240461 - 240283
Alignment:
| Q |
47 |
aatttgtatacaccgcactcaatgataccacttttttaggttaatttctaaaacatctctataactaattacttggcatgttttgattagatgcaatata |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240461 |
aatttgtatacaccgcactcaatgataccacttttttgggttaatttctaaaatatctctataactaattacttggcatgttttgattagatgcaatata |
240362 |
T |
|
| Q |
147 |
agcaagtaaaaatagtcacataaaatatgccacacacatacnnnnnnncacccatatcaagtcaaatacacaagcatcctct |
228 |
Q |
| |
|
|| |||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
240361 |
agtaagt-aaaatagtcacat--aatatgccacacacatacaaaaaaacacccatatcaagtcaaatacacaagcatcctct |
240283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 240551 - 240505
Alignment:
| Q |
1 |
ttatacaccggaaaaccgatatgacttgtgaaaccataaatgtgaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240551 |
ttatacaccggaaaaccgatatgacttgtgaaaccataaatgtgaaa |
240505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 104
Target Start/End: Original strand, 44599484 - 44599522
Alignment:
| Q |
66 |
caatgataccacttttttaggttaatttctaaaacatct |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
44599484 |
caatgataccacttctttaggttaatttctaaaatatct |
44599522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University