View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_315 (Length: 230)
Name: NF10233A_low_315
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_315 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 30634592 - 30634364
Alignment:
| Q |
2 |
caatggtaaaaatcacaaccccattaccctatttcgatagagtcgcatacacagtacgactcgagggaatacgggtcgggaagaagctgctccaattacc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634592 |
caatggtaaaaatcacaaccccattaccctatttcgatcgagtcgcatacacagtacgactcgagggaatacgggtcgggaagaagctgctccaattacc |
30634493 |
T |
|
| Q |
102 |
caaaacaattttcgcaccggatcataccggtgcgggtcagacaatggtggattcaggtacacagttcacgtttcttttgggaccggtttacagtgcttta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634492 |
caaaacaattttcgcaccggatcataccggtgcgggtcagacaatggtggattcgggtacacagttcacgtttcttttgggaccggtttacagtgcttta |
30634393 |
T |
|
| Q |
202 |
agacaagaatttgtagaacaaacaaaagg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30634392 |
agacaagaatttgtagaacaaacaaaagg |
30634364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University