View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_317 (Length: 229)
Name: NF10233A_low_317
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_317 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 9985370 - 9985583
Alignment:
| Q |
16 |
caaactttatacttgaagggattaacataacatcttctataggagaggaaattcatgcatcatgcaaaaatgtaaatggggtatgcacttcatgtatacc |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
9985370 |
caaacattatacttgaagggattaacataacatcttctataggagaggaagttcatgcatcatgcaaaaatgtaaatggagtatgcacttcatgcatacc |
9985469 |
T |
|
| Q |
116 |
ttatgttccatgtctttccctagagtgaccaagtttttgtgacaatttgtgtccatattatattgtaggctaccatataggccaagaaaattgtgatagg |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985470 |
ttatgttccatgtctttctctagagtgaccaagtttttgtgacaatttgtgtccatattatattgtaggctaccatataggccaagaaaattgtgatagg |
9985569 |
T |
|
| Q |
216 |
ccctaaattatatt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9985570 |
ccctaaattatatt |
9985583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University