View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_322 (Length: 228)
Name: NF10233A_low_322
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_322 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 1329873 - 1330086
Alignment:
| Q |
9 |
gagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329873 |
gagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggt |
1329972 |
T |
 |
| Q |
109 |
atgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttggttcagccggaaggccag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329973 |
atgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttggttcagccggaaggccag |
1330072 |
T |
 |
| Q |
209 |
caatgctagcattg |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1330073 |
caatgctagcattg |
1330086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University