View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_354 (Length: 218)
Name: NF10233A_low_354
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_354 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 43895948 - 43896136
Alignment:
| Q |
15 |
acatcaatattttttataaattaattatatttgtagacatctactaatatatctggaggcatatggttttataaatnnnnnnnntaaaatctggaggcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43895948 |
acatcaatattttttataaattaattatatttgtagatatctactaatatatctggaggcatatggttttataaataagaaa---aaaatctggaggcat |
43896044 |
T |
|
| Q |
115 |
ggtaaaaacttgtaaaaattgactaatatcaccgacgcttggtagattgatttggcttaatcggtaagtatgtatatcgctatattcttgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
43896045 |
ggtaaaaacttgtaaaaattgactaatatcaccgacgcttgggagattgatttggctagatcggtaagtatgtatatcgctatatttttgga |
43896136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University