View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_361 (Length: 214)
Name: NF10233A_low_361
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_361 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 63 - 214
Target Start/End: Original strand, 43170216 - 43170367
Alignment:
| Q |
63 |
ttatgttaaagttggtcagtcatcttgagttacctgtaagaaaggtgagcttcttatcggattttgtgcaaccacctcattgtcgaccatgatgcaaaag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
43170216 |
ttatgttaaagttggtcagtcatcttgagttacctgtaagaaaagtgagctgcttatcggattttgcgcaaccaccttaatgtcgaccatgatgcaaaag |
43170315 |
T |
 |
| Q |
163 |
ggaaataaaatacatttatactgctagaagttgaaatgcagcgttgcaaatg |
214 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
43170316 |
ggaaataaaatacattgatgctgctagaagttgaaatgcagcgttacaaatg |
43170367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University