View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_371 (Length: 208)
Name: NF10233A_low_371
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_371 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 120 - 208
Target Start/End: Complemental strand, 1899348 - 1899260
Alignment:
| Q |
120 |
tttgtgtcacggaaatcaaagtactaagaagnnnnnnncacaagttgcatgtagttatgtcttctgtcatttgccacctttccctattt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1899348 |
tttgtgtcacggaaatcaaagtactaagaagaaaaaaacacaagttgcatgtagttatgtcttctgtcatttgccacctttccctattt |
1899260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 1899470 - 1899416
Alignment:
| Q |
12 |
ttctagaggtttggttgtgattagctcaagagaatgagaaggttgttcacattca |
66 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1899470 |
ttctagaggtttggttgtgattagcacaagagaatgagaaggttgttcacattca |
1899416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University