View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_372 (Length: 207)
Name: NF10233A_low_372
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_372 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 42 - 194
Target Start/End: Complemental strand, 13312115 - 13311964
Alignment:
| Q |
42 |
atcaatttattaagattctcgaagagatattcataattggaagagatgtagacacattgaccacagtacctgcttgtctgcggacttaatgatgcaatta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13312115 |
atcaatttattaagattctcgaagagatattcataattggaaga-atgtagacacattgaccacagtacctgcttgtctgcggacttaatgatgcaatta |
13312017 |
T |
|
| Q |
142 |
gggtggttatgtcatatagataaagattgtctaacagggcccatgatgtccat |
194 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13312016 |
gggtggttatgtgatatagataaagattgtctaacagggccaatgatgtccat |
13311964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 39 - 194
Target Start/End: Original strand, 12908024 - 12908179
Alignment:
| Q |
39 |
gacatcaatttattaagattctcgaagagatattcataattggaagagatgtagacacattgaccacagtacctgcttgtctgcggacttaatgatgcaa |
138 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||||| ||| |||| ||||| || |||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
12908024 |
gacagcaatttattaagatactcgaagggatattcataataggatgagaggtagaaactttgaccacagtacctgcttgtctgtagacttaacgatgcaa |
12908123 |
T |
|
| Q |
139 |
ttagggtggttatgtcatatagataaagattgtctaacagggcccatgatgtccat |
194 |
Q |
| |
|
||||||||||||||| | | |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
12908124 |
ttagggtggttatgtgacacagattgagattgtctaacagggccaatgatgtccat |
12908179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University