View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_374 (Length: 207)
Name: NF10233A_low_374
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_374 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 52763360 - 52763560
Alignment:
| Q |
7 |
tcgaagaatattaaaaaagggtagttggtaatggactcaaaacatttgtatgaacaaatcctttattagttagtattcctcttagagataggtttaagca |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52763360 |
tcgaagaaaattaaaaaagggtagttggtaatggactcaaatcatctgtatgaacaaatcctttattaggtagtattcctcttagagataggtttaagca |
52763459 |
T |
|
| Q |
107 |
gttgtttgagttggctgaaaatcgttggattttggcggcggagatgttttctttagggtgggtgggggtgtgggaggggttatgagggcatcacagtggc |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||| |||||||||| ||||| | |||||| |
|
|
| T |
52763460 |
gttgtttgaattggctgaaaatcgttggattttagcggcggagatgttttatttagggtgggtgggggtgggggtggggttatgaaggcataaaagtggc |
52763559 |
T |
|
| Q |
207 |
g |
207 |
Q |
| |
|
| |
|
|
| T |
52763560 |
g |
52763560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University