View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_377 (Length: 206)
Name: NF10233A_low_377
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_377 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 32 - 185
Target Start/End: Complemental strand, 37938773 - 37938620
Alignment:
| Q |
32 |
gaacagaatgaggcaaagacagctacaattgaagcaggggagaccgagacaaaggtggaagaaatctctaaagctgtaaatgaacctgttagagaaacac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37938773 |
gaacagaatgaggcaaagacagctacaattgaagcaggggagaccgagacaaaggtggaagaaatctctaaagctgtaaatgaacctgttagagaaacac |
37938674 |
T |
|
| Q |
132 |
tggcttctaaattcgaaaaagacgaggaggaaactattcaaaatggagtggata |
185 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37938673 |
ttgcatctaaattcgaaaaagacgaggaggaaactattcaaaatggagtggata |
37938620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University