View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_61 (Length: 347)
Name: NF10233A_low_61
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_61 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 196 - 347
Target Start/End: Complemental strand, 1109169 - 1109022
Alignment:
| Q |
196 |
aatatatgctttcttcttcacatccttatacgtatttctctgcacatgatctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
295 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109169 |
aatatatgctttcttcttcacatcgttatacatatttctctg-ac---atctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
1109074 |
T |
|
| Q |
296 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgtt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109073 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgtt |
1109022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University