View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_65 (Length: 344)
Name: NF10233A_low_65
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 9e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 181 - 339
Target Start/End: Complemental strand, 7303778 - 7303625
Alignment:
| Q |
181 |
ttgaccttgagccaaaatcttcacatgataatttctatttttatccaaaatgttaagtgaaagaaatttttaa-tggaatatttgttggcattaaagatt |
279 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
7303778 |
ttgaccttgagccaaattcttaccatgataatttctatttttatccaaaatgttaagtgaaaggaattttcaaatggaatatttgttggcattaaagatt |
7303679 |
T |
|
| Q |
280 |
atattgtggatatagaatttgagattaactataacttctatttttgcctcattaccaact |
339 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7303678 |
atattgtggatatagaatttgagatt------aacttctatttttgcctcattaccaact |
7303625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 37 - 154
Target Start/End: Complemental strand, 7303961 - 7303844
Alignment:
| Q |
37 |
tcttatgaactctaatattaagtttattaggagacaaacaaaccaagttgctcatagtttggctaggaaggcttcgcctatagcaaatttccgtattttc |
136 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
7303961 |
tcttatgaactctaatgttaagtttattaggagacaaacaaaccaagttgctcatagtttggttagggaggcttcgcctatagctaatttccgtattttc |
7303862 |
T |
|
| Q |
137 |
tataacattccaacatgt |
154 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7303861 |
tataacattccaacatgt |
7303844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 791947 - 791991
Alignment:
| Q |
58 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
102 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
791947 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
791991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 94
Target Start/End: Complemental strand, 32639676 - 32639619
Alignment:
| Q |
37 |
tcttatgaactctaatattaagtttattaggagacaaacaaaccaagttgctcatagt |
94 |
Q |
| |
|
||||||||||||| ||||||| || ||||| |||||| ||||| || ||||||||||| |
|
|
| T |
32639676 |
tcttatgaactctgatattaaattaattagaagacaagcaaacaaaattgctcatagt |
32639619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 4052865 - 4052909
Alignment:
| Q |
58 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
102 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
4052865 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
4052909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 25070942 - 25070898
Alignment:
| Q |
58 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
102 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
25070942 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
25070898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University