View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_68 (Length: 338)
Name: NF10233A_low_68
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_68 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 20 - 317
Target Start/End: Original strand, 11037350 - 11037642
Alignment:
| Q |
20 |
atcaagcaacatactcattgatcgtcaatggaactctaaggtttctgatttcggtcttgctaagcttctgcattctgaccacagctatgtcacgactcga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037350 |
atcaagcaacatactcattgatcgtcaatggaactctaaggtttctgatttcggtcttgctaagcttctgcattctgaccacagctatgtcacgactcga |
11037449 |
T |
|
| Q |
120 |
gtgatggggacatttgggttagtatgatt-gacaaagcattctcctatctctgttaccagttacaattactttcgattcatgtaagaacgcaatgtgttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11037450 |
gtgatggggacatttgggttagtatgatttgacaaagcat------atctctgttaccagttacaattactttcgtttcatgtaagaacgcaatgtgttg |
11037543 |
T |
|
| Q |
219 |
ctagttgaggtctattgacattgtctctatctctttctctttctgcagttatgttgcacccgagtatgcctgcactggaatgctgaccgagaggagtga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037544 |
ctagttgaggtctattgacattgtctctatccctttctctttctgcagttatgttgcacccgagtatgcctgcactggaatgctgaccgagaggagtga |
11037642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 20 - 148
Target Start/End: Complemental strand, 29789184 - 29789056
Alignment:
| Q |
20 |
atcaagcaacatactcattgatcgtcaatggaactctaaggtttctgatttcggtcttgctaagcttctgcattctgaccacagctatgtcacgactcga |
119 |
Q |
| |
|
|||||| ||||| ||| ||||||| ||||||||||| ||||| ||||||||||| ||||| |||||| | |||| || | || ||||||||||||||| |
|
|
| T |
29789184 |
atcaagtaacatcctccttgatcgccaatggaactccaaggtgtctgatttcgggcttgccaagcttttaaattccgagaatagttatgtcacgactcga |
29789085 |
T |
|
| Q |
120 |
gtgatggggacatttgggttagtatgatt |
148 |
Q |
| |
|
|| |||||||||||||||| ||||||||| |
|
|
| T |
29789084 |
gttatggggacatttgggtaagtatgatt |
29789056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 29788919 - 29788864
Alignment:
| Q |
265 |
agttatgttgcacccgagtatgcctgcactggaatgctgaccgagaggagtgatgt |
320 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
29788919 |
agttatgttgcaccagaatatgcctgcaccggaatgctgaccgagaagagtgatgt |
29788864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University