View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_72 (Length: 333)
Name: NF10233A_low_72
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 103 - 330
Target Start/End: Original strand, 28795651 - 28795877
Alignment:
| Q |
103 |
aattgttgaacaacggtggtgaaagtggtgattgaggatggttgaagtagcggttggtggtggtcagagtggtggttaaattggagatcaaagatgaata |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28795651 |
aattgttgaacagcggtggtgaaagtggtgattgaggatggttgaagtagcggttggtggttgtcagagtggtggttaaattggagatcaagg-tgaata |
28795749 |
T |
 |
| Q |
203 |
gagtgttgatcagaattgaggtccaaggcagatgttgttttgttggcctaccccttgggtcaggtatgaattagacacagacgactaaacctgtgagaca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28795750 |
gagtgttgatcagaattgaggtccaaggcatatgttgttttgttggcctaccccttgggtcaggtatgaattagacatagacgactaaacctgtgagaca |
28795849 |
T |
 |
| Q |
303 |
tgcactcacatacttttggatattttta |
330 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28795850 |
tgcactcacatacttttggatattttta |
28795877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University