View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_75 (Length: 331)
Name: NF10233A_low_75
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_75 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 6 - 331
Target Start/End: Original strand, 2819388 - 2819713
Alignment:
| Q |
6 |
gatggacatcaagcaacattctatatacacaataaatgtccctttccaatatggccagcaacagcaccaaacactggtcaaccaattatagcagatggtg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2819388 |
gatggacatcaagcaacattctatatacacaataaatgtccctttccaatatggcctgcaacagcaccaaacactggtcaaccaattatagcagatggtg |
2819487 |
T |
|
| Q |
106 |
gattctaccttccttcaggccaaacaaagaaaattctagcaccatggtcatggagtggtagaatttgggctagaacaggttgcaattttgcttcaaataa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2819488 |
gattctaccttccttcaggccaaacaaagaaaattctagcaccatggtcatggagtggtagaatttgggctagaacaggttgcaattttgcttcaaataa |
2819587 |
T |
|
| Q |
206 |
ttggaaaccatcttgtgaaactggggattgtgatggaagattagcttgcaatggactcattggaacacctccagctacattagttgagatcacacttcaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2819588 |
ttggaaaccatcttgtgaaactggggattgtgatggaagattagcttgcaatggactcattggaacacctccagctacattagttgaaatcacacttcaa |
2819687 |
T |
|
| Q |
306 |
ggtgataaagggaaaccaaatttcta |
331 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
2819688 |
ggtgataaagggagaccaaatttcta |
2819713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University