View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_79 (Length: 328)
Name: NF10233A_low_79
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_79 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 117 - 309
Target Start/End: Complemental strand, 149871 - 149679
Alignment:
| Q |
117 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
217 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgatgatgattgttgatgttggtgatg |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgatgatgattgttgatgttggtgatg |
149679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 149990 - 149943
Alignment:
| Q |
1 |
taaaggtgttgtttgaggttgttg---aggtagatttgaaggggaagg |
45 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
149990 |
taaaggtgttgtttgaggttgttgttgaggtagatttgaaggtgaagg |
149943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University