View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_81 (Length: 325)
Name: NF10233A_low_81
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_81 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 30778441 - 30778747
Alignment:
| Q |
19 |
atcaaaggctaagttgttaattttcgattgtaaccatctaaaagaagaaaacttcacgatgttcaccggttgctgtatcgattgatctatatgtcgaaaa |
118 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
30778441 |
atcaaaagctaagttgttaattttcggttgtaaccatctaaaagaagaaaatttcacgatattcaccggttgttgtatcgattg-tctatatgtcgaaaa |
30778539 |
T |
 |
| Q |
119 |
atacgactattcttgtccttccaaac-tcttaaacaaccgacaactaaatcacatggagacgtcttcttccacggttaccctagcctatcaatcccccat |
217 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
30778540 |
atacgactattcttatccttccaaatatcttaaacaaccgacaactaaatcacatggagacgtcttcttccaccgctatcctagcctatcaatcccccat |
30778639 |
T |
 |
| Q |
218 |
gctagcctcctaatctccactaaggtaacatctttatcaaacgtaaatcaaaaagacgccaaaacctaacccacaaacttgcaccatgcagtcaaagatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30778640 |
gctagcctcctaatctccactaaggtaacacctttatcaaacgtaaatcaaaaggacgccaaaacctaacccacaaaccttcaccatgcagtcaaagatc |
30778739 |
T |
 |
| Q |
318 |
acaccaaa |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
30778740 |
acaccaaa |
30778747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University