View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10233A_low_99 (Length: 308)

Name: NF10233A_low_99
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10233A_low_99
NF10233A_low_99
[»] chr5 (1 HSPs)
chr5 (92-156)||(4395404-4395467)


Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 92 - 156
Target Start/End: Complemental strand, 4395467 - 4395404
Alignment:
92 tgagatgaaccaaaacaattatttgtnnnnnnnctatatgtattgaaactacaccacaaaacctt 156  Q
    ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
4395467 tgagatgaaccaaaacaattatttgtaaaaaa-ctatatgtattgaaactacaccacaaaacctt 4395404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University