View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10234_low_14 (Length: 254)
Name: NF10234_low_14
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10234_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 6179857 - 6179682
Alignment:
| Q |
12 |
aagcataggtggtatacatggcaatcattcatgtgtcggaggccgaggaaccaacatccccctaacgatgccttgagatgaaacgactctgcactctacc |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| | | |
|
|
| T |
6179857 |
aagcataggtggtatacatggcaaacatccatgtgtcggaggccgaggaaccaacatctccctaacgatgccttaagatgaaatgactctgcactccatc |
6179758 |
T |
 |
| Q |
112 |
tctcttctatatgattcaatactatgttttggaacagaggaaggttccaactcaaaattgtcccttttgtctccgc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6179757 |
tctcttctatatgattcaatactatgttttggaatagaggaaggttccaactcaaaattgccccttttgtctccgc |
6179682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 183 - 254
Target Start/End: Complemental strand, 6179270 - 6179199
Alignment:
| Q |
183 |
tccgcgtcagaaacacacctcagggaaccacaaccactttaccgtcaagctccaaaccctccaaattagact |
254 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179270 |
tccgcgtcagaaacacacctcaaggaaccagaaccactttaccgtcaagctccaaaccctccaaattagact |
6179199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University