View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10234_low_23 (Length: 241)
Name: NF10234_low_23
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10234_low_23 |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0275 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 55 - 225
Target Start/End: Complemental strand, 11231 - 11060
Alignment:
| Q |
55 |
tagcttttcacaaccttcccaccgaagacatagccgagccagtgaggtttt-atacattaagtttcctacaaataaatagttatcaaaatgaacattttc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11231 |
tagcttttcacaaccttcccaccgaagacatagccaagctagtgaagtttttatacattaagtttcctacaaataaatagttatcaaaatgaacattttc |
11132 |
T |
 |
| Q |
154 |
ttcttttaccattttgctctcaacttcattcctattttctagcagtatctgatttgtatgtctgaagcaagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11131 |
ttcttttaccattttgctctcaacttcatccttattttctagcagtatctgattggtatgtctgaagcaagt |
11060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University