View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10234_low_29 (Length: 233)
Name: NF10234_low_29
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10234_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 219
Target Start/End: Original strand, 23595473 - 23595669
Alignment:
| Q |
23 |
aacactgttttcggtaagtattctcaagttcttgatcgttgattttccaaagtttttattctgtttcagtatttgtttctttaatgtcacaattaatcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23595473 |
aacactgttttcggtaagtattctcaagttcttgatcgttgattttccgaagtttttattctgtttcagtatttgtttctttaatgtcacaattaatcaa |
23595572 |
T |
 |
| Q |
123 |
gcatacatgatttgaaatttctaatgcataaggtagaaaagtaaatgtaattgctcatcctgataaaattgctgatcttcatcttgattaggttctt |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23595573 |
gcatgcatgatttgaaatttctaatgcataaggtagaaaagtaaatgtaattgctcatcctgataaaattgttgatcttcatcttgattaggttctt |
23595669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University