View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10234_low_30 (Length: 232)
Name: NF10234_low_30
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10234_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 3408177 - 3408395
Alignment:
| Q |
1 |
tggaagtatctcaatggttgatggctactttcttgtctgttttaaccaagaaaaggattaataacacgcactgttcaaagggccgtggaggannnnnnn- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
3408177 |
tggaagtatctcaatggttgatggctactttcttgtctgttttaaccaagaaaaggattaataacacgcgctgttcaaagggacgtggaggatttttttt |
3408276 |
T |
 |
| Q |
100 |
--gacactatataatggtccaacaatggcgtcacatgtttcttcaaactacgaacattatgaaaaatattttggtacaaatttgtataccacatgtctcc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3408277 |
ttgacactatataatggtccaacaatggcgtcacatgtttcttcaaactaccaacattatgaaaaatattttggtacaaatttgtataccacgtgtctcc |
3408376 |
T |
 |
| Q |
198 |
acgaatctttatagcatag |
216 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
3408377 |
acaaatctttatagcatag |
3408395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University