View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10234_low_36 (Length: 216)
Name: NF10234_low_36
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10234_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 4141643 - 4141446
Alignment:
| Q |
1 |
tattttttgcaatgtatgctcaaggatgcacaaattttatataatgtttgctacaaatcttgcatgtacagtatgaattgagataccgcgatggtcgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4141643 |
tattttttgcaatgtatgctcaaggatgcacaaatcttatataatgtttgctacaaatcttgcatgtacagtatgaattgagataccgcgatggtcacaa |
4141544 |
T |
|
| Q |
101 |
tgggtatataaagaacgacaaagttataggagtgtagagcaaaatgaattacttatattgaactggttttctaccaacaaaggtagtatagtgtctct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4141543 |
tgggtatataaagaacgacaaagttataggagtgtagagcaaaatgaattacttatattgaactggttttctatcaacaaaggtagtatagtgtctct |
4141446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 3755079 - 3755115
Alignment:
| Q |
5 |
ttttgcaatgtatgctcaaggatgcacaaattttata |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3755079 |
ttttgcaatgtatgctcaaggatgcagaaattttata |
3755115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 64
Target Start/End: Complemental strand, 2677807 - 2677757
Alignment:
| Q |
12 |
atgtatgctcaaggatgcacaaattttatataatgtttgctacaaatcttgca |
64 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
2677807 |
atgtatgcttaaggatgcacaaattt--tataatgtttacttcaaatcttgca |
2677757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 173
Target Start/End: Original strand, 3755121 - 3755157
Alignment:
| Q |
137 |
gagcaaaatgaattacttatattgaactggttttcta |
173 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
3755121 |
gagccaaatgaattacttatactgaactggttttcta |
3755157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University