View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10234_low_36 (Length: 216)

Name: NF10234_low_36
Description: NF10234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10234_low_36
NF10234_low_36
[»] chr3 (4 HSPs)
chr3 (1-198)||(4141446-4141643)
chr3 (5-41)||(3755079-3755115)
chr3 (12-64)||(2677757-2677807)
chr3 (137-173)||(3755121-3755157)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 4141643 - 4141446
Alignment:
1 tattttttgcaatgtatgctcaaggatgcacaaattttatataatgtttgctacaaatcttgcatgtacagtatgaattgagataccgcgatggtcgcaa 100  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
4141643 tattttttgcaatgtatgctcaaggatgcacaaatcttatataatgtttgctacaaatcttgcatgtacagtatgaattgagataccgcgatggtcacaa 4141544  T
101 tgggtatataaagaacgacaaagttataggagtgtagagcaaaatgaattacttatattgaactggttttctaccaacaaaggtagtatagtgtctct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
4141543 tgggtatataaagaacgacaaagttataggagtgtagagcaaaatgaattacttatattgaactggttttctatcaacaaaggtagtatagtgtctct 4141446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 3755079 - 3755115
Alignment:
5 ttttgcaatgtatgctcaaggatgcacaaattttata 41  Q
    |||||||||||||||||||||||||| ||||||||||    
3755079 ttttgcaatgtatgctcaaggatgcagaaattttata 3755115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 64
Target Start/End: Complemental strand, 2677807 - 2677757
Alignment:
12 atgtatgctcaaggatgcacaaattttatataatgtttgctacaaatcttgca 64  Q
    ||||||||| ||||||||||||||||  |||||||||| || |||||||||||    
2677807 atgtatgcttaaggatgcacaaattt--tataatgtttacttcaaatcttgca 2677757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 173
Target Start/End: Original strand, 3755121 - 3755157
Alignment:
137 gagcaaaatgaattacttatattgaactggttttcta 173  Q
    |||| |||||||||||||||| |||||||||||||||    
3755121 gagccaaatgaattacttatactgaactggttttcta 3755157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University