View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10235_low_5 (Length: 251)
Name: NF10235_low_5
Description: NF10235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10235_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 105 - 246
Target Start/End: Complemental strand, 6903860 - 6903717
Alignment:
| Q |
105 |
tgttgtttaagctcaaacacaacttgaagtgtctcaaacaaattgttataagttaatgaaagatattagaagctcgtgagagcaaatattttaccaaatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6903860 |
tgttgtttaagctcaaacacaacttggagtgtctcaaacaaattgttataagctaatgaaagatattagaagctcgtgagagcaaatattttaccaaata |
6903761 |
T |
|
| Q |
205 |
attataggttcaccgttcaaact--gaatattattcatctcact |
246 |
Q |
| |
|
| ||||| || ||| |||||||| ||||||||||||||||||| |
|
|
| T |
6903760 |
actatagttttaccattcaaacttcgaatattattcatctcact |
6903717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University