View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10235_low_6 (Length: 250)
Name: NF10235_low_6
Description: NF10235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10235_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 18095787 - 18096008
Alignment:
| Q |
1 |
tggaatggccacttcctcttcaacagcaaggtgacaatgccaatcaatttccttttccttttcaaatgggtggtggtaacgaaatcaatgtcaatgacat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18095787 |
tggattggccacttcctcttcaacagcaaggtgacaatgccaatcaatttccttttccttttcaaatgggtggtggtaacgaaatcaatgtcaatgactt |
18095886 |
T |
|
| Q |
101 |
tgcttttctagagggtgatgtgggtgatgaaaatgccaatctttttcctgttcaagtgggtggtggtaacaatgccaacgccaatctctttccttttcaa |
200 |
Q |
| |
|
||||||| | | | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18095887 |
tgcttttttt-----tcaagtgggtgatgaaaatgccaatctttttccttttcaagtgggtggtggtaacaatgccaacgccaatctctttccttttcaa |
18095981 |
T |
|
| Q |
201 |
gtgggcaacaacaatgactatgccaat |
227 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
18095982 |
gtgggcaacaacaatgacaatgccaat |
18096008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 18081570 - 18081613
Alignment:
| Q |
1 |
tggaatggccacttcctcttcaacagcaaggtgacaatgccaat |
44 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
18081570 |
tggaatggccacttcctcttcaacaacaaggtaacaatgccaat |
18081613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University