View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_high_10 (Length: 303)
Name: NF10236_high_10
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 12056904 - 12056629
Alignment:
| Q |
19 |
gttttaatgtcacggtgaataatcggtggttgagcgtatttgtgtaaatattctatacccctagccgcgtctaaggcgacttttatacgaccactccatg |
118 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
12056904 |
gttttaatgtcacggtgaataattggcggttgagcgtatttgtgtaaatattcaatacccctagccgcgtctaaagcgacttttatacgaccgctccatg |
12056805 |
T |
|
| Q |
119 |
acataattgttgaagtttgaaacttatgaagatggtcgtttaagcttccgttgttcatgtattcgtacactaagattcgctcatttttgtcttcatagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12056804 |
acataattgttgaagtttgaaacttatgaagatggtcgtttaagcttccgttgttcatatattcgtagactaagattcgctcatttttgtcttcatagaa |
12056705 |
T |
|
| Q |
219 |
accaagtaatttgaccaagtttttgtggtggagtcttgataaagattcaagttcattcacaaacgcactgtctgtg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12056704 |
accaagtaatttgaccaagtttttgtggtggagtcttgataaagattcaagttcattcacaaacgcactgtctgtg |
12056629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University