View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_high_12 (Length: 276)
Name: NF10236_high_12
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 26277583 - 26277849
Alignment:
| Q |
1 |
tgcaattgagaaagctgtggagctgaattggtcggacatatggattgaaacggactcacttatggtggtgaaagctttctctcaacacattgcagttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277583 |
tgcaattgagaaagctgtggagctgaattggtcggacatatggattgaaacggactcacttatggtggtgaaagctttctctcaacacattgcagttcct |
26277682 |
T |
|
| Q |
101 |
tggactttgagagttagatggcgcaattgtatag-cttaccgagactttttcttgtcgtttcacacacatccatagggagtgtaactctggccaatgagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277683 |
tggactttgagagttagatggcgcaattgtatagccttaccgagactttttcttgtcgttccacacacatccatagggagtgtaactctggccaatgagt |
26277782 |
T |
|
| Q |
200 |
aagttaagcatggtcatagtttacactcacaatggtggacggatcccccacatttattttgcctttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277783 |
aagttaagcatggtcatagtttacactcacaatggtggacggatcccccacatttattttgcctttg |
26277849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University