View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_high_13 (Length: 269)
Name: NF10236_high_13
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_high_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 45917131 - 45916863
Alignment:
| Q |
1 |
gagctttctaatccttcagatacaggaatgtctaatccttcagatacagatattgacattcctggaaactttgattagaaggtaccaagtaattcatcat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45917131 |
gagctttctaatccttcagatgcaggaatgtctaatccttcagatacagatattgacattcctggaaactttgattagaaggtaccaagtaattcattat |
45917032 |
T |
|
| Q |
101 |
gtgggtgttttagacaacagtccattcgttggatattcttcatgtagatatgggatgcagctctagaagcaatgatattagacaattgtgaaagtagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45917031 |
gtgggtgttttagacaacagtccattcgttggatattcttcatgtagatatgggatgcagctctagaagcaatgatattagacaattgtgaaagtagttt |
45916932 |
T |
|
| Q |
201 |
atgactgtatgtaacagcgaaatgaagtggtaatcctatcaagggaggagaagctctgatcttcaagcc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45916931 |
atgactgtatgtaacagcgaaatgaagtggtaatcctatcaagggtggagaagctctgatcttcaagcc |
45916863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University