View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10236_high_21 (Length: 218)
Name: NF10236_high_21
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10236_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 42679372 - 42679501
Alignment:
| Q |
1 |
tatgtccagcaacaccaataggtcttgaacacatctttatgaatttata--tcgggatagtaacacgcgatattttctgcttcaggaatatgtacagcca |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42679372 |
tatgtccagcaacaccaataggttttgaacacatctttatgaatttatatatcgggatagtaacacgcgatattttctgcttcaggaatatgtacagcca |
42679471 |
T |
 |
| Q |
99 |
ccgactatatagcgtcccttgatcaaatgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42679472 |
ccgactatatagcgtcccttgatcaaatgt |
42679501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 211
Target Start/End: Original strand, 42679519 - 42679581
Alignment:
| Q |
149 |
ctataacctttcacgcaacaacnnnnnnnnatacattctatacaattctttcttctctctcga |
211 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
42679519 |
ctataacctttcacgcaaccacttttttttatacattctatacaattctttcttctttctcga |
42679581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University