View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10236_high_21 (Length: 218)

Name: NF10236_high_21
Description: NF10236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10236_high_21
NF10236_high_21
[»] chr5 (2 HSPs)
chr5 (1-128)||(42679372-42679501)
chr5 (149-211)||(42679519-42679581)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 42679372 - 42679501
Alignment:
1 tatgtccagcaacaccaataggtcttgaacacatctttatgaatttata--tcgggatagtaacacgcgatattttctgcttcaggaatatgtacagcca 98  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
42679372 tatgtccagcaacaccaataggttttgaacacatctttatgaatttatatatcgggatagtaacacgcgatattttctgcttcaggaatatgtacagcca 42679471  T
99 ccgactatatagcgtcccttgatcaaatgt 128  Q
    ||||||||||||||||||||||||||||||    
42679472 ccgactatatagcgtcccttgatcaaatgt 42679501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 211
Target Start/End: Original strand, 42679519 - 42679581
Alignment:
149 ctataacctttcacgcaacaacnnnnnnnnatacattctatacaattctttcttctctctcga 211  Q
    ||||||||||||||||||| ||        |||||||||||||||||||||||||| ||||||    
42679519 ctataacctttcacgcaaccacttttttttatacattctatacaattctttcttctttctcga 42679581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University